Single-cell RNA sequencing of Tocilizumab-treated peripheral blood mononuclear cells


The RNase J-Based mostly RNA Degradosome Is Compartmentalized within the Gastric Pathogen Helicobacter pylori

Posttranscriptional regulation is a serious degree of gene expression management in any cell. In micro organism, multiprotein machines known as RNA degradosomes are central for RNA processing and degradation, and a few had been reported to be compartmentalized inside these organelleless cells. The minimal RNA degradosome of the essential gastric pathogen Helicobacter pylori consists of the important ribonuclease RNase J and RhpA, its sole DEAD field RNA helicase, and performs a serious position within the regulation of mRNA decay and adaptation to gastric colonization.

Right here, the subcellular localization of the H. pylori RNA degradosome was investigated utilizing mobile fractionation and each confocal and superresolution microscopy. 

We established that RNase J and RhpA are peripheral internal membrane proteins and that this affiliation was mediated neither by ribosomes nor by RNA nor by the RNase Y membrane protein. In dwell H. pylori cells, we noticed that fluorescent RNase J and RhpA protein fusions assemble into nonpolar foci. We recognized components that regulate the formation of those foci with out affecting the degradosome membrane affiliation.  

Flotillin, a bacterial membrane scaffolding protein, and free RNA promote focus formation in H. pylori Lastly, RNase J-GFP (RNase J-green fluorescent protein) molecules and foci in cells had been quantified by three-dimensional (3D) single-molecule fluorescence localization microscopy. 

The quantity and dimension of the RNase J foci had been discovered to be scaled with progress section and cell quantity as beforehand reported for eukaryotic ribonucleoprotein granules. In conclusion, we suggest that membrane compartmentalization and the regulated clustering of RNase J-based degradosome hubs symbolize essential ranges of management of their exercise and specificity.

 IMPORTANCE Helicobacter pylori is a bacterial pathogen that chronically colonizes the abdomen of half of the human inhabitants worldwide. An infection by H. pylori can result in the event of gastric pathologies akin to ulcers and adenocarcinoma, which causes as much as 800,000 deaths on this planet every year.

 Persistent colonization by H. pylori depends on regulation of the expression of adaptation-related genes. One main degree of such management is posttranscriptional regulation, which, in H. pylori, largely depends on a multiprotein molecular machine, an RNA degradosome, that we beforehand found. On this research, we established that the 2 protein companions of this machine are related to the membrane of H. pylori Utilizing cutting-edge microscopy, we confirmed that these complexes assemble into hubs whose formation is regulated by free RNA and scaled with bacterial dimension and progress section. Organelleless mobile compartmentalization of molecular machines into hubs emerges as an essential regulatory degree in micro organism.  


PEG3 Antibody

34056-50ul 50ul
EUR 187

PEG3 Antibody

43302-100ul 100ul
EUR 252

PEG3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

PEG3 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PEG3 Antibody

CSB-PA022042-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PEG3 Antibody

AF9152 200ul
EUR 304
Description: PEG3 Antibody detects endogenous levels of total PEG3.

PEG3 Antibody

ABF9152 100 ug
EUR 438

Anti-PEG3 Antibody

A02541 100ul
EUR 397
Description: Rabbit Polyclonal PEG3 Antibody. Validated in WB and tested in Human.

PEG3 Conjugated Antibody

C34056 100ul
EUR 397

PEG3 Polyclonal Antibody

ABP55568-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090
  • Applications tips:
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090

PEG3 Polyclonal Antibody

ABP55568-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090
  • Applications tips:
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090

PEG3 Polyclonal Antibody

ABP55568-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090
  • Applications tips:
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090

PEG3 Polyclonal Antibody

ES6567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PEG3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PEG3 Polyclonal Antibody

ES6567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PEG3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-PEG3 antibody

STJ114545 100 µl
EUR 277
Description: In human, ZIM2 and PEG3 are treated as two distinct genes though they share multiple 5' exons and a common promoter and both genes are paternally expressed (PMID:15203203). Alternative splicing events connect their shared 5' exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. In contrast, in other mammals ZIM2 does not undergo imprinting and, in mouse, cow, and likely other mammals as well, the ZIM2 and PEG3 genes do not share exons. Human PEG3 protein belongs to the Kruppel C2H2-type zinc finger protein family. PEG3 may play a role in cell proliferation and p53-mediated apoptosis. PEG3 has also shown tumor suppressor activity and tumorigenesis in glioma and ovarian cells. Alternative splicing of this PEG3 gene results in multiple transcript variants encoding distinct isoforms.

Anti-PEG3 antibody

STJ95024 200 µl
EUR 197
Description: Rabbit polyclonal to PEG3.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


HY-W007545 100mg
EUR 108

PEG3 Rabbit pAb

A12671-100ul 100 ul
EUR 308

PEG3 Rabbit pAb

A12671-200ul 200 ul
EUR 459

PEG3 Rabbit pAb

A12671-20ul 20 ul
EUR 183

PEG3 Rabbit pAb

A12671-50ul 50 ul
EUR 223


  • EUR 509.00
  • EUR 690.00
  • 0.5 g
  • 1 g
  • Shipped within 1-2 weeks.


  • EUR 272.00
  • EUR 467.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.


  • EUR 370.00
  • EUR 829.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.


  • EUR 537.00
  • EUR 829.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.


  • EUR 244.00
  • EUR 439.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.


abx186382-1g 1 g
EUR 787
  • Shipped within 1-2 weeks.


abx186609-250mg 250 mg
EUR 439
  • Shipped within 1-2 weeks.


  • EUR 300.00
  • EUR 606.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.


  • EUR 537.00
  • EUR 1595.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.


  • EUR 370.00
  • EUR 746.00
  • 0.5 g
  • 1 g
  • Shipped within 1-2 weeks.


  • EUR 648.00
  • EUR 1233.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.


  • EUR 217.00
  • EUR 272.00
  • 1 g
  • 25 g
  • Shipped within 1-2 weeks.


  • EUR 676.00
  • EUR 843.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.


ADC-L-121 unit Ask for price

PEG3 Blocking Peptide

AF9152-BP 1mg
EUR 195


HY-128767 5mg
EUR 113


H-7924.0500 0.5mg
EUR 383
Description: Sum Formula: C50H75N13O24


H-7924.1000 1.0mg
EUR 618
Description: Sum Formula: C50H75N13O24


HY-42637 100mg
EUR 153


HY-111377 10mg
EUR 211


HY-W017772 100mg
EUR 142

Paternally Expressed 3 (PEG3) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Paternally Expressed 3 (PEG3) Antibody

abx331093-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Paternally Expressed 3 (PEG3) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

PEG3-tetrazine, 1 g

1978-1g 1 g
EUR 661

PEG3-tetrazine, 250 mg

1978-250mg 250 mg
EUR 305


  • EUR 495.00
  • EUR 4114.00
  • EUR 1274.00
  • 1 g
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.


  • EUR 551.00
  • EUR 1219.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.

Bis-PEG3-NHS Ester

ADC-L-120 unit Ask for price

Mouse PEG3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PEG3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


HY-128801 100mg
EUR 131

Azide-PEG3-Azide, 1 g

207-1g 1 g
EUR 101

Azide-PEG3-Azide, 5 g

207-5g 5 g
EUR 320

Azide-PEG3-Amine, 1 g

218-1g 1 g
EUR 93

Azide-PEG3-Amine, 5 g

218-5g 5 g
EUR 230

PEG3 dicarboxylic acid, 10 g

1715-10g 10 g
EUR 910

PEG3 dicarboxylic acid, 1 g

1715-1g 1 g
EUR 353

PEG3 dicarboxylic acid, 5 g

1715-5g 5 g
EUR 613

Alkyne-PEG3-COOH, 1 g

1743-1g 1 g
EUR 349

Alkyne-PEG3-COOH, 5 g

1743-5g 5 g
EUR 661

Alkyne-PEG3-OH, 1 g

418-1g 1 g
EUR 93

Alkyne-PEG3-OH, 5 g

418-5g 5 g
EUR 230

Biotin PEG3 azide, 25 mg

D3730 25 mg
EUR 97

Biotin PEG3 azide, 50 mg

E3730 50 mg
EUR 130

Biotin PEG3 azide, 10 mg

C3730 10 mg
EUR 60

N3-PEG3-C2-NHS ester

HY-126528 500mg
EUR 3264

Pomalidomide-PEG3-C2-NH2 (TFA)

HY-128716A 2g
EUR 5675

NHPI-PEG3-C2-Pfp ester

HY-130092 100mg
EUR 843

NHPI-PEG3-C2-NHS ester

HY-130093 100mg
EUR 843


HY-42776 100mg
EUR 108


HY-100874 5mg
EUR 1221

Biotin PEG3 azide, 100 mg

F3730 100 mg
EUR 156

PEG3 ORF Vector (Human) (pORF)

ORF027601 1.0 ug DNA
EUR 659

Peg3 ORF Vector (Mouse) (pORF)

ORF053769 1.0 ug DNA
EUR 1572

TMP-PEG3-amine, trifluoroacetic acid salt

91056 1MG
EUR 195
Description: Minimum order quantity: 1 unit of 1MG


HY-130098 100mg
EUR 578


HY-130100 100mg
EUR 843


HY-103598 2g
EUR 5675


HY-103602A 1g
EUR 3896


HY-107440 2g
EUR 5675

Peg3 sgRNA CRISPR Lentivector set (Mouse)

K4341801 3 x 1.0 ug
EUR 339

PEG3 sgRNA CRISPR Lentivector set (Human)

K1626501 3 x 1.0 ug
EUR 339

PEG3-AS1 ORF Vector (Human) (pORF)

ORF027602 1.0 ug DNA Ask for price

Ald-Ph-amido-PEG3-C2-Pfp ester

HY-130102 100mg
EUR 843

(S,R,S)-AHPC-PEG3-NH2 (hydrochloride)

HY-103602 25mg
EUR 234

Thalidomide-O-amido-PEG3-C2-NH2 (TFA)

HY-103611 2g
EUR 5675

Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4341802 1.0 ug DNA
EUR 154

Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4341803 1.0 ug DNA
EUR 154

Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4341804 1.0 ug DNA
EUR 154

PEG3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1626502 1.0 ug DNA
EUR 154

PEG3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1626503 1.0 ug DNA
EUR 154

PEG3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1626504 1.0 ug DNA
EUR 154

PEG3 Protein Vector (Human) (pPB-C-His)

PV110402 500 ng
EUR 2280

PEG3 Protein Vector (Human) (pPB-N-His)

PV110403 500 ng
EUR 2280

PEG3 Protein Vector (Human) (pPM-C-HA)

PV110404 500 ng
EUR 2280

PEG3 Protein Vector (Human) (pPM-C-His)

PV110405 500 ng
EUR 2280

PEG3 Protein Vector (Mouse) (pPB-C-His)

PV215074 500 ng
EUR 2646

PEG3 Protein Vector (Mouse) (pPB-N-His)

PV215075 500 ng
EUR 2646

PEG3 Protein Vector (Mouse) (pPM-C-HA)

PV215076 500 ng
EUR 2646

PEG3 Protein Vector (Mouse) (pPM-C-His)

PV215077 500 ng
EUR 2646

Peg3 3'UTR Luciferase Stable Cell Line

TU116185 1.0 ml Ask for price

Peg3 3'UTR GFP Stable Cell Line

TU166185 1.0 ml Ask for price

PEG3 3'UTR GFP Stable Cell Line

TU067722 1.0 ml
EUR 2333

PEG3 3'UTR Luciferase Stable Cell Line

TU017722 1.0 ml
EUR 2333

Anti-ERBB2 (trastuzumab)-Amino-PEG3-Propionyl-MMAE ADC

ADC-W-629 1mg Ask for price
Description: This ADC product is comprised of an engineerd anti-ERBB2 antibody (trastuzumab with LLQGG tag at Fc) conjugated via a Amino-PEG3-Propionyl linker to MMAE


HY-103605 1g
EUR 3896

Mouse Paternally- expressed gene 3 protein, Peg3 ELISA KIT

ELI-20913m 96 Tests
EUR 865

Human Paternally- expressed gene 3 protein, PEG3 ELISA KIT

ELI-22084h 96 Tests
EUR 824

Bovine Paternally- expressed gene 3 protein, PEG3 ELISA KIT

ELI-45910b 96 Tests
EUR 928

PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV772727 1.0 ug DNA Ask for price

PEG3-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV772731 1.0 ug DNA Ask for price

PEG3-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV772732 1.0 ug DNA Ask for price

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4341805 3 x 1.0 ug
EUR 376

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1626505 3 x 1.0 ug
EUR 376

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4341808 1.0 ug DNA
EUR 167

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4341806 1.0 ug DNA
EUR 167

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4341807 1.0 ug DNA
EUR 167

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1626506 1.0 ug DNA
EUR 167

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1626507 1.0 ug DNA
EUR 167

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1626508 1.0 ug DNA
EUR 167

PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV772729 1.0 ug DNA Ask for price

PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV772730 1.0 ug DNA Ask for price

H2B Antibody Antibody

AF4659 200ul
EUR 376
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody

ABD2911 100 ug
EUR 438

anti- Antibody^Polyclonal antibody control antibody

LSMab09882 100 ug
EUR 438

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx036399-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx234901-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx230204-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Single-cell RNA sequencing of Tocilizumab-treated peripheral blood mononuclear cells as an in vitro mannequin of irritation

COVID-19 has posed a major risk to international well being. Early knowledge has revealed that IL-6, a key regulatory cytokine, performs an essential position within the cytokine storm of COVID-19. A number of trials are due to this fact wanting on the results of Tocilizumab, an IL-6 receptor antibody that inhibits IL-6 exercise, on remedy of COVID-19, with promising findings. 

As a part of a scientific trial wanting on the results of Tocilizumab remedy on kidney transplant recipients with subclinical rejection, we carried out single-cell RNA sequencing of evaluating stimulated PBMCs earlier than and after Tocilizumab remedy. We leveraged this knowledge to create an in vitro cytokine storm mannequin, to higher perceive the consequences of Tocilizumab within the presence of irritation. Tocilizumab-treated cells had lowered expression of inflammatory-mediated genes and biologic pathways, notably amongst monocytes. These outcomes help the speculation that Tocilizumab might hinder the cytokine storm of COVID-19, by way of an indication of biologic influence on the single-cell degree.   

Useful Characterization of a Putative RNA Demethylase ALKBH6 in Arabidopsis Development and Abiotic Stress Responses

RNA methylation and demethylation, which is mediated by RNA methyltransferases (known as “writers”) and demethylases (known as “erasers”), respectively, are rising as a key regulatory course of in plant growth and stress responses. Though a number of research have proven that AlkB homolog (ALKBH) proteins are potential RNA demethylases, the operate of most ALKBHs is but to be decided. 

 The Arabidopsis thaliana genome accommodates 13 genes encoding ALKBH proteins, the capabilities of that are largely unknown. On this research, we characterised the operate of a possible eraser protein, ALKBH6 (At4g20350), throughout seed germination and seedling progress in Arabidopsis below abiotic stresses. The seeds of T-DNA insertion alkbh6 knockdown mutants germinated quicker than the wild-type seeds below chilly, salt, or abscisic acid (ABA) remedy situations however not below dehydration stress situations. 

Though no variations in seedling and root progress had been noticed between the alkbh6 mutant and wild-type below regular situations, the alkbh6 mutant confirmed a a lot decrease survival fee than the wild-type below salt, drought, or warmth stress. Cotyledon greening of the alkbh6 mutants was a lot greater than that of the wild-type upon ABA utility.  Furthermore, the transcript ranges of ABA signaling-related genes, together with ABI3 and ABI4, had been down-regulated within the alkbh6 mutant in comparison with wild-type vegetation. Importantly, the ALKBH6 protein had a capability to bind to each m6A-labeled and m5C-labeled RNAs. Collectively, these outcomes point out that the potential eraser ALKBH6 performs essential roles in seed germination, seedling progress, and survival of Arabidopsis below abiotic stresses.  

GNAS antibody
70R-1651 100 ug
EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the C terminal of GNAS
GNAS antibody
70R-1652 100 ug
EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS
GNAS antibody
70R-12940 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GNAS antibody
GNAS antibody
70R-13520 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GNAS antibody
GNAS antibody
70R-21619 50 ul
EUR 435
Description: Rabbit polyclonal GNAS antibody
GNAS Antibody
32899-100ul 100ul
EUR 252
GNAS antibody
38452-100ul 100ul
EUR 252
GNAS Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
GNAS Antibody
DF7068 200ul
EUR 304
Description: GNAS Antibody detects endogenous levels of total GNAS.
GNAS Antibody
DF7388 200ul
EUR 304
Description: GNAS Antibody detects endogenous levels of total GNAS.
GNAS Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500
GNAS Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
GNAS Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100
GNAS antibody
70R-5756 50 ug
EUR 467
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS
GNAS Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
GNAS Antibody
ABD7068 100 ug
EUR 438
GNAS Antibody
ABD7388 100 ug
EUR 438
GNAS Complex Locus (GNAS) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
GNAS Complex Locus (GNAS) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
GNAS Complex Locus (GNAS) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
GNAS complex locus (GNAS) polyclonal antibody
ABP-PAB-11314 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:
GNAS Conjugated Antibody
C32899 100ul
EUR 397
NESP55,GNAS Antibody
abx235663-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
GNAS Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
GNAS Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
GNAS Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
GNAS Polyclonal Antibody
A68803 100 ?g
EUR 628.55
Description: Ask the seller for details
GNAS Polyclonal Antibody
A64422 100 µg
EUR 570.55
Description: The best epigenetics products
anti- GNAS antibody
FNab03536 100µg
EUR 505.25
  • Immunogen: GNAS complex locus
  • Uniprot ID: O95467
  • Gene ID: 2778
  • Research Area: Neuroscience, Cancer, Immunology, Signal Transduction
Description: Antibody raised against GNAS
Anti-GNAS antibody
PAab03536 100 ug
EUR 355
Anti-GNAS antibody
STJ27492 100 µl
EUR 277
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.
Anti-GNAS antibody
STJ23816 100 µl
EUR 277
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.
Anti-GNAS antibody
STJ72252 100 µg
EUR 359
Gnas/ Rat Gnas ELISA Kit
ELI-12714r 96 Tests
EUR 886
Gnas/ Rat Gnas ELISA Kit
ELI-27931r 96 Tests
EUR 886
Gnas/ Rat Gnas ELISA Kit
ELI-35065r 96 Tests
EUR 886
Gnas/ Rat Gnas ELISA Kit
ELI-47242r 96 Tests
EUR 886
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PVT17793 2 ug
EUR 231
Polyclonal GNAS Antibody (Center)
APR05815G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (Center). This antibody is tested and proven to work in the following applications:
GNAS Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
GNAS Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
GNAS Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
GNAS Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
GNAS Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
GNAS Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
anti- NESP55,GNAS antibody
FNab05663 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:50-1:500
  • Immunogen: GNAS complex locus
  • Uniprot ID: O95467
  • Research Area: cancer, Metabolism
Description: Antibody raised against NESP55,GNAS
Polyclonal GNAS Antibody (C-term)
APR04328G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal GNAS Antibody (internal region)
APG00677G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GNAS (internal region). This antibody is tested and proven to work in the following applications:
Polyclonal GNAS Antibody (aa385-394)
APR02185G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (aa385-394). This antibody is tested and proven to work in the following applications:
Monoclonal GNAS Antibody, Clone: 7G6G5
AMM03034G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 7G6G5. This antibody is applicable in WB and IHC, FC, ICC, E
Monoclonal GNAS Antibody, Clone: 2A2B7
AMM03035G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 2A2B7. This antibody is applicable in WB and IHC, FC, ICC, E
Polyclonal GNAS Antibody (N-Term)
AMM04827G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (N-Term). This antibody is tested and proven to work in the following applications:
GNAS Polyclonal Antibody, HRP Conjugated
A68804 100 ?g
EUR 628.55
Description: The best epigenetics products
GNAS Polyclonal Antibody, FITC Conjugated
A68805 100 ?g
EUR 628.55
Description: kits suitable for this type of research
GNAS Polyclonal Antibody, Biotin Conjugated
A68806 100 ?g
EUR 628.55
Description: fast delivery possible
GNAS Polyclonal Antibody, HRP Conjugated
A64423 100 µg
EUR 570.55
Description: kits suitable for this type of research
GNAS Polyclonal Antibody, FITC Conjugated
A64424 100 µg
EUR 570.55
Description: fast delivery possible
GNAS Polyclonal Antibody, Biotin Conjugated
A64425 100 µg
EUR 570.55
Description: reagents widely cited
GNAS Blocking Peptide
33R-10097 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1651
GNAS Blocking Peptide
33R-8471 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1652
GNAS Blocking Peptide
33R-9925 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-5756
GNAS Blocking Peptide
33R-6814 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1643
GNAS Blocking Peptide
DF7068-BP 1mg
EUR 195
GNAS Blocking Peptide
DF7388-BP 1mg
EUR 195
GNAS cloning plasmid
CSB-CL009596HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1185
  • Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc
  • Show more
Description: A cloning plasmid for the GNAS gene.
GNAS cloning plasmid
CSB-CL009596HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1188
  • Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc
  • Show more
Description: A cloning plasmid for the GNAS gene.
GNAS Rabbit pAb
A5546-100ul 100 ul
EUR 308
GNAS Rabbit pAb
A5546-200ul 200 ul
EUR 459
GNAS Rabbit pAb
A5546-20ul 20 ul
EUR 183
GNAS Rabbit pAb
A5546-50ul 50 ul
EUR 223
GNAS Rabbit pAb
A2732-100ul 100 ul
EUR 308
GNAS Rabbit pAb
A2732-200ul 200 ul
EUR 459
GNAS Rabbit pAb
A2732-20ul 20 ul
EUR 183
GNAS Rabbit pAb
A2732-50ul 50 ul
EUR 223
Recombinant human GNAS
P1012 100ug Ask for price
  • Uniprot ID: O95467
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human GNAS
pSV40- Gnas- m
PVT11671 2 ug
EUR 273
ELI-12712h 96 Tests
EUR 824
Mouse Gnas ELISA KIT
ELI-12713m 96 Tests
EUR 865
ELI-27250d 96 Tests
EUR 928
EF009911 96 Tests
EUR 689
Rat GNAS shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat GNAS shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GNAS shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GNAS shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GNAS shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GNAS shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse GNAS shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse GNAS shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse GNAS shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse GNAS shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-38027b 96 Tests
EUR 928
Mouse Gnas ELISA KIT
ELI-48020m 96 Tests
EUR 865
ELI-48772h 96 Tests
EUR 824
EF001179 96 Tests
EUR 689
Gnas ORF Vector (Rat) (pORF)
ORF067655 1.0 ug DNA
EUR 506
Gnas ORF Vector (Rat) (pORF)
ORF067656 1.0 ug DNA
EUR 506
Gnas ORF Vector (Rat) (pORF)
ORF067657 1.0 ug DNA
EUR 506
Gnas ORF Vector (Rat) (pORF)
ORF067658 1.0 ug DNA
EUR 506
Gnas ORF Vector (Rat) (pORF)
ORF067659 1.0 ug DNA
EUR 506
GNAS ORF Vector (Human) (pORF)
ORF004496 1.0 ug DNA
EUR 95
GNAS ORF Vector (Human) (pORF)
ORF004497 1.0 ug DNA
EUR 95
Gnas ORF Vector (Mouse) (pORF)
ORF046308 1.0 ug DNA
EUR 506
Gnas ORF Vector (Mouse) (pORF)
ORF046309 1.0 ug DNA
EUR 506
Gnas ORF Vector (Mouse) (pORF)
ORF046310 1.0 ug DNA
EUR 506
Gnas ORF Vector (Mouse) (pORF)
ORF046311 1.0 ug DNA
EUR 506
Gnas ORF Vector (Mouse) (pORF)
ORF046312 1.0 ug DNA
EUR 506
Gnas ORF Vector (Mouse) (pORF)
ORF046313 1.0 ug DNA
EUR 506
Gnas ORF Vector (Mouse) (pORF)
ORF046314 1.0 ug DNA
EUR 506
Gnas ORF Vector (Mouse) (pORF)
ORF046315 1.0 ug DNA
EUR 506
GNAS ELISA Kit (Human) (OKCA01388)
OKCA01388 96 Wells
EUR 846
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL
GNAS ELISA Kit (Rat) (OKCA01910)
OKCA01910 96 Wells
EUR 846
Description: Description of target: Guanine nucleotide-binding proteins (G proteins) function as transducers in numerous signaling pathways controlled by G protein-coupled receptors (GPCRs). Signaling involves the activation of adenylyl cyclases, resulting in increased levels of the signaling molecule cAMP. GNAS functions downstream of several GPCRs, including beta-adrenergic receptors. XLas isoforms interact with the same set of receptors as Gnas isoforms.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL
GNAS ELISA Kit (Human) (OKEH08012)
OKEH08012 96 Wells
EUR 896
Description: Description of target: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.128ng/mL
GNAS ELISA Kit (Human) (OKWB00174)
OKWB00174 96 Wells
EUR 572
Description: Description of target: Guanine nucleotide-binding proteins (G proteins) function as transducers in numerous signaling pathways controlled by G protein-coupled receptors (GPCRs). Signaling involves the activation of adenylyl cyclases, resulting in increased levels of the signaling molecule cAMP. GNAS functions downstream of several GPCRs, including beta-adrenergic receptors. Stimulates the Ras signaling pathway via RAPGEF2.;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 46.9 nmol/mL
Mouse Protein ALEX, Gnas ELISA KIT
ELI-24352m 96 Tests
EUR 865
ELI-24547h 96 Tests
EUR 824
Gnas sgRNA CRISPR Lentivector set (Rat)
K7535001 3 x 1.0 ug
EUR 339
Gnas sgRNA CRISPR Lentivector set (Mouse)
K4363501 3 x 1.0 ug
EUR 339
GNAS sgRNA CRISPR Lentivector set (Human)
K0875301 3 x 1.0 ug
EUR 339
GNAS-AS1 ORF Vector (Human) (pORF)
ORF020250 1.0 ug DNA
EUR 95
pECMV-3脳FLAG-GNAS vector
PVT12057 2 ug
EUR 352
Mouse Neuroendocrine Secretory Protein (GNAS) ELISA Kit
abx392277-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Neuroendocrine Secretory Protein (GNAS) ELISA Kit
abx392284-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Neuroendocrine Secretory Protein (GNAS) ELISA Kit
abx387603-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Gnas sgRNA CRISPR Lentivector (Rat) (Target 1)
K7535002 1.0 ug DNA
EUR 154
Gnas sgRNA CRISPR Lentivector (Rat) (Target 2)
K7535003 1.0 ug DNA
EUR 154
Gnas sgRNA CRISPR Lentivector (Rat) (Target 3)
K7535004 1.0 ug DNA
EUR 154
Gnas sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4363502 1.0 ug DNA
EUR 154
Gnas sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4363503 1.0 ug DNA
EUR 154
Gnas sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4363504 1.0 ug DNA
EUR 154
GNAS sgRNA CRISPR Lentivector (Human) (Target 1)
K0875302 1.0 ug DNA
EUR 154
GNAS sgRNA CRISPR Lentivector (Human) (Target 2)
K0875303 1.0 ug DNA
EUR 154
GNAS sgRNA CRISPR Lentivector (Human) (Target 3)
K0875304 1.0 ug DNA
EUR 154
GNAS Protein Vector (Rat) (pPB-C-His)
PV270618 500 ng
EUR 603
GNAS Protein Vector (Rat) (pPB-N-His)
PV270619 500 ng
EUR 603
GNAS Protein Vector (Rat) (pPM-C-HA)
PV270620 500 ng
EUR 603
GNAS Protein Vector (Rat) (pPM-C-His)
PV270621 500 ng
EUR 603
GNAS Protein Vector (Rat) (pPB-C-His)
PV270622 500 ng
EUR 603
GNAS Protein Vector (Rat) (pPB-N-His)
PV270623 500 ng
EUR 603
GNAS Protein Vector (Rat) (pPM-C-HA)
PV270624 500 ng
EUR 603
GNAS Protein Vector (Rat) (pPM-C-His)
PV270625 500 ng
EUR 603
GNAS Protein Vector (Rat) (pPB-C-His)
PV270626 500 ng
EUR 1166
GNAS Protein Vector (Rat) (pPB-N-His)
PV270627 500 ng
EUR 1166
GNAS Protein Vector (Rat) (pPM-C-HA)
PV270628 500 ng
EUR 1166
GNAS Protein Vector (Rat) (pPM-C-His)
PV270629 500 ng
EUR 1166
GNAS Protein Vector (Rat) (pPB-C-His)
PV270630 500 ng
EUR 1166
GNAS Protein Vector (Rat) (pPB-N-His)
PV270631 500 ng
EUR 1166
GNAS Protein Vector (Rat) (pPM-C-HA)
PV270632 500 ng
EUR 1166
GNAS Protein Vector (Rat) (pPM-C-His)
PV270633 500 ng
EUR 1166
GNAS Protein Vector (Rat) (pPB-C-His)
PV270634 500 ng
EUR 603

Leave a Reply

Your email address will not be published. Required fields are marked *