Single-cell RNA sequencing of Tocilizumab-treated peripheral blood mononuclear cells

microbiologica

The RNase J-Based mostly RNA Degradosome Is Compartmentalized within the Gastric Pathogen Helicobacter pylori

Posttranscriptional regulation is a serious degree of gene expression management in any cell. In micro organism, multiprotein machines known as RNA degradosomes are central for RNA processing and degradation, and a few had been reported to be compartmentalized inside these organelleless cells. The minimal RNA degradosome of the essential gastric pathogen Helicobacter pylori consists of the important ribonuclease RNase J and RhpA, its sole DEAD field RNA helicase, and performs a serious position within the regulation of mRNA decay and adaptation to gastric colonization.

Right here, the subcellular localization of the H. pylori RNA degradosome was investigated utilizing mobile fractionation and each confocal and superresolution microscopy. 

We established that RNase J and RhpA are peripheral internal membrane proteins and that this affiliation was mediated neither by ribosomes nor by RNA nor by the RNase Y membrane protein. In dwell H. pylori cells, we noticed that fluorescent RNase J and RhpA protein fusions assemble into nonpolar foci. We recognized components that regulate the formation of those foci with out affecting the degradosome membrane affiliation.  

Flotillin, a bacterial membrane scaffolding protein, and free RNA promote focus formation in H. pylori Lastly, RNase J-GFP (RNase J-green fluorescent protein) molecules and foci in cells had been quantified by three-dimensional (3D) single-molecule fluorescence localization microscopy. 

The quantity and dimension of the RNase J foci had been discovered to be scaled with progress section and cell quantity as beforehand reported for eukaryotic ribonucleoprotein granules. In conclusion, we suggest that membrane compartmentalization and the regulated clustering of RNase J-based degradosome hubs symbolize essential ranges of management of their exercise and specificity.

 IMPORTANCE Helicobacter pylori is a bacterial pathogen that chronically colonizes the abdomen of half of the human inhabitants worldwide. An infection by H. pylori can result in the event of gastric pathologies akin to ulcers and adenocarcinoma, which causes as much as 800,000 deaths on this planet every year.

 Persistent colonization by H. pylori depends on regulation of the expression of adaptation-related genes. One main degree of such management is posttranscriptional regulation, which, in H. pylori, largely depends on a multiprotein molecular machine, an RNA degradosome, that we beforehand found. On this research, we established that the 2 protein companions of this machine are related to the membrane of H. pylori Utilizing cutting-edge microscopy, we confirmed that these complexes assemble into hubs whose formation is regulated by free RNA and scaled with bacterial dimension and progress section. Organelleless mobile compartmentalization of molecular machines into hubs emerges as an essential regulatory degree in micro organism.  

microbiologica
microbiologica

PEG3 antibody

70R-32122 100 ug
EUR 327.00
Description: Rabbit polyclonal PEG3 antibody

PEG3 Antibody

34056-100ul 100ul
EUR 252.00

PEG3 Antibody

34056-50ul 50ul
EUR 187.00

PEG3 Antibody

43302-100ul 100ul
EUR 252.00

PEG3 Antibody

CSB-PA022042-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PEG3 Antibody

CSB-PA022042-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PEG3 Antibody

1-CSB-PA030033
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

PEG3 Conjugated Antibody

C34056 100ul
EUR 397.00

PEG3 Polyclonal Antibody

ES6567-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against PEG3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PEG3 Polyclonal Antibody

ES6567-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against PEG3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PEG3 Polyclonal Antibody

ABP55568-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090
  • Applications tips:
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090

PEG3 Polyclonal Antibody

ABP55568-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090
  • Applications tips:
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090

PEG3 Polyclonal Antibody

ABP55568-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090
  • Applications tips:
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090

Anti-PEG3 Antibody

A02541 100ul
EUR 397.00
Description: Rabbit Polyclonal PEG3 Antibody. Validated in WB and tested in Human.

Anti-PEG3 antibody

STJ95024 200 µl
EUR 197.00
Description: Rabbit polyclonal to PEG3.

Anti-PEG3 antibody

STJ114545 100 µl
EUR 277.00
Description: In human, ZIM2 and PEG3 are treated as two distinct genes though they share multiple 5' exons and a common promoter and both genes are paternally expressed (PMID:15203203). Alternative splicing events connect their shared 5' exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. In contrast, in other mammals ZIM2 does not undergo imprinting and, in mouse, cow, and likely other mammals as well, the ZIM2 and PEG3 genes do not share exons. Human PEG3 protein belongs to the Kruppel C2H2-type zinc finger protein family. PEG3 may play a role in cell proliferation and p53-mediated apoptosis. PEG3 has also shown tumor suppressor activity and tumorigenesis in glioma and ovarian cells. Alternative splicing of this PEG3 gene results in multiple transcript variants encoding distinct isoforms.

NH2-PEG3

HY-W007545 100mg
EUR 108.00

PEG3 siRNA

20-abx928229
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PEG3 siRNA

20-abx928230
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PEG3 Blocking Peptide

AF9152-BP 1mg
EUR 195.00

NHS-PEG3-NHS

ADC-L-121 unit Ask for price

Amine-PEG3-Biotin

HY-111377 10mg
EUR 211.00

N3-PEG3-CH2COOH

HY-42637 100mg
EUR 153.00

VH032-PEG3-acetylene

HY-128767 5mg
EUR 113.00

Azido-PEG3-FLAG

H-7924.0500 0.5mg
EUR 383.00
Description: Sum Formula: C50H75N13O24

Azido-PEG3-FLAG

H-7924.1000 1.0mg
EUR 618.00
Description: Sum Formula: C50H75N13O24

Boc-NH-PEG3

HY-W017772 100mg
EUR 142.00

OH-PEG3-Tos

20-abx085425
  • EUR 648.00
  • EUR 1233.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

Tos-PEG3-Tos

20-abx085426
  • EUR 217.00
  • EUR 272.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

COOH-PEG3-COOH

20-abx085430
  • EUR 676.00
  • EUR 843.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

N3-PEG3-NH2

20-abx186135
  • EUR 272.00
  • EUR 467.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

N3-PEG3-OH

20-abx186195
  • EUR 370.00
  • EUR 829.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

Alkyne-PEG3-Alkyne

20-abx186246
  • EUR 537.00
  • EUR 829.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

OH-PEG3-CH2CH2COOtBu

20-abx186258
  • EUR 244.00
  • EUR 439.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

Biotin-PEG3-Azide

abx186382-1g 1 g
EUR 787.00
  • Shipped within 1-2 weeks.

Methyl-PEG3-MS

abx186609-250mg 250 mg
EUR 439.00
  • Shipped within 1-2 weeks.

NH2-PEG3-NH2

20-abx186613
  • EUR 300.00
  • EUR 606.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

NH2-PEG3-COOH

20-abx186616
  • EUR 537.00
  • EUR 1595.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

Bromo-PEG3-azide

20-abx186630
  • EUR 370.00
  • EUR 746.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

propargyl-PEG3-Acid

20-abx180861
  • EUR 509.00
  • EUR 690.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

PEG3 Rabbit pAb

A12671-100ul 100 ul
EUR 308.00

PEG3 Rabbit pAb

A12671-200ul 200 ul
EUR 459.00

PEG3 Rabbit pAb

A12671-20ul 20 ul
EUR 183.00

PEG3 Rabbit pAb

A12671-50ul 50 ul
EUR 223.00

Paternally Expressed 3 (PEG3) Antibody

20-abx013786
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Paternally Expressed 3 (PEG3) Antibody

20-abx323448
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Paternally Expressed 3 (PEG3) Antibody

abx331093-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Bis-PEG3-NHS Ester

ADC-L-120 unit Ask for price

NH2-PEG3-C1-Boc

HY-128801 100mg
EUR 131.00

Fmoc-nh-peg3-ch2cooh

20-abx180768
  • EUR 495.00
  • EUR 4114.00
  • EUR 1274.00
  • 0
  • 1
  • 2
  • Shipped within 1-2 weeks.

Boc-NH-PEG3-NH2

20-abx180877
  • EUR 551.00
  • EUR 1219.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

Human PEG3 shRNA Plasmid

20-abx953456
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

PEG3-tetrazine, 1 g

1978-1g 1 g
EUR 661.00

PEG3-tetrazine, 250 mg

1978-250mg 250 mg
EUR 305.00

Mouse PEG3 shRNA Plasmid

20-abx971994
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Biotin PEG3 azide, 10 mg

C3730 10 mg
EUR 60.00

Biotin PEG3 azide, 50 mg

E3730 50 mg
EUR 130.00

N3-PEG3-vc-PAB-MMAE

HY-100874 5mg
EUR 1221.00

NH2-PEG3-C2-NH-Boc

HY-42776 100mg
EUR 108.00

N3-PEG3-C2-NHS ester

HY-126528 500mg
EUR 3264.00

Pomalidomide-PEG3-C2-NH2 (TFA)

HY-128716A 2g
EUR 5675.00

NHPI-PEG3-C2-Pfp ester

HY-130092 100mg
EUR 843.00

NHPI-PEG3-C2-NHS ester

HY-130093 100mg
EUR 843.00

Biotin PEG3 azide, 100 mg

F3730 100 mg
EUR 156.00

Alkyne-PEG3-OH, 1 g

418-1g 1 g
EUR 93.00

Alkyne-PEG3-OH, 5 g

418-5g 5 g
EUR 230.00

PEG3 dicarboxylic acid, 10 g

1715-10g 10 g
EUR 910.00

PEG3 dicarboxylic acid, 1 g

1715-1g 1 g
EUR 353.00

PEG3 dicarboxylic acid, 5 g

1715-5g 5 g
EUR 613.00

Alkyne-PEG3-COOH, 1 g

1743-1g 1 g
EUR 349.00

Alkyne-PEG3-COOH, 5 g

1743-5g 5 g
EUR 661.00

Azide-PEG3-Amine, 1 g

218-1g 1 g
EUR 93.00

Azide-PEG3-Amine, 5 g

218-5g 5 g
EUR 230.00

Azide-PEG3-Azide, 1 g

207-1g 1 g
EUR 101.00

Azide-PEG3-Azide, 5 g

207-5g 5 g
EUR 320.00

Biotin PEG3 azide, 25 mg

D3730 25 mg
EUR 97.00

PEG3 ORF Vector (Human) (pORF)

ORF027601 1.0 ug DNA
EUR 659.00

Peg3 ORF Vector (Mouse) (pORF)

ORF053769 1.0 ug DNA
EUR 1572.00

(S,R,S)-AHPC-PEG3-N3

HY-103598 2g
EUR 5675.00

(S,R,S)-AHPC-PEG3-NH2

HY-103602A 1g
EUR 3896.00

Thalidomide-O-amido-PEG3-C2-NH2

HY-107440 2g
EUR 5675.00

Ald-Ph-amido-PEG3-C-COOH

HY-130098 100mg
EUR 578.00

Ald-Ph-amido-PEG3-C1-Boc

HY-130100 100mg
EUR 843.00

TMP-PEG3-amine, trifluoroacetic acid salt

91056 1MG
EUR 195.00
Description: Minimum order quantity: 1 unit of 1MG

PEG3 sgRNA CRISPR Lentivector set (Human)

K1626501 3 x 1.0 ug
EUR 339.00

Peg3 sgRNA CRISPR Lentivector set (Mouse)

K4341801 3 x 1.0 ug
EUR 339.00

PEG3-AS1 ORF Vector (Human) (pORF)

ORF027602 1.0 ug DNA Ask for price

(S,R,S)-AHPC-PEG3-NH2 (hydrochloride)

HY-103602 25mg
EUR 234.00

Thalidomide-O-amido-PEG3-C2-NH2 (TFA)

HY-103611 2g
EUR 5675.00

Ald-Ph-amido-PEG3-C2-Pfp ester

HY-130102 100mg
EUR 843.00

PEG3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1626502 1.0 ug DNA
EUR 154.00

PEG3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1626503 1.0 ug DNA
EUR 154.00

PEG3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1626504 1.0 ug DNA
EUR 154.00

Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4341802 1.0 ug DNA
EUR 154.00

Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4341803 1.0 ug DNA
EUR 154.00

Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4341804 1.0 ug DNA
EUR 154.00

PEG3 Protein Vector (Human) (pPB-C-His)

PV110402 500 ng
EUR 2280.00

PEG3 Protein Vector (Human) (pPB-N-His)

PV110403 500 ng
EUR 2280.00

PEG3 Protein Vector (Human) (pPM-C-HA)

PV110404 500 ng
EUR 2280.00

PEG3 Protein Vector (Human) (pPM-C-His)

PV110405 500 ng
EUR 2280.00

PEG3 Protein Vector (Mouse) (pPB-C-His)

PV215074 500 ng
EUR 2646.00

PEG3 Protein Vector (Mouse) (pPB-N-His)

PV215075 500 ng
EUR 2646.00

PEG3 Protein Vector (Mouse) (pPM-C-HA)

PV215076 500 ng
EUR 2646.00

PEG3 Protein Vector (Mouse) (pPM-C-His)

PV215077 500 ng
EUR 2646.00

Peg3 3'UTR GFP Stable Cell Line

TU166185 1.0 ml Ask for price

PEG3 3'UTR Luciferase Stable Cell Line

TU017722 1.0 ml
EUR 2333.00

Peg3 3'UTR Luciferase Stable Cell Line

TU116185 1.0 ml Ask for price

PEG3 3'UTR GFP Stable Cell Line

TU067722 1.0 ml
EUR 2333.00

Anti-ERBB2 (trastuzumab)-Amino-PEG3-Propionyl-MMAE ADC

ADC-W-629 1mg Ask for price
Description: This ADC product is comprised of an engineerd anti-ERBB2 antibody (trastuzumab with LLQGG tag at Fc) conjugated via a Amino-PEG3-Propionyl linker to MMAE

(S,R,S)-AHPC-C6-PEG3-C4-Cl

HY-103605 1g
EUR 3896.00

Mouse Paternally- expressed gene 3 protein, Peg3 ELISA KIT

ELI-20913m 96 Tests
EUR 865.00

Human Paternally- expressed gene 3 protein, PEG3 ELISA KIT

ELI-22084h 96 Tests
EUR 824.00

Bovine Paternally- expressed gene 3 protein, PEG3 ELISA KIT

ELI-45910b 96 Tests
EUR 928.00

PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV772727 1.0 ug DNA Ask for price

PEG3-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV772731 1.0 ug DNA Ask for price

PEG3-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV772732 1.0 ug DNA Ask for price

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1626505 3 x 1.0 ug
EUR 376.00

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4341805 3 x 1.0 ug
EUR 376.00

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1626506 1.0 ug DNA
EUR 167.00

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1626507 1.0 ug DNA
EUR 167.00

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1626508 1.0 ug DNA
EUR 167.00

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4341806 1.0 ug DNA
EUR 167.00

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4341807 1.0 ug DNA
EUR 167.00

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4341808 1.0 ug DNA
EUR 167.00

PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV772729 1.0 ug DNA Ask for price

PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV772730 1.0 ug DNA Ask for price

H2B Antibody Antibody

AF4659 200ul
EUR 376.00
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody

ABD2911 100 ug
EUR 438.00

anti- Antibody^Polyclonal antibody control antibody

LSMab09882 100 ug
EUR 438.00

Ly1 Antibody Reactive (LYAR) Antibody

20-abx123734
  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx036399-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx008109
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

20-abx004855
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx014333
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx324434
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319900
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319901
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319905
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319913
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx311665
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx234901-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx230204-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277.00

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277.00
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277.00
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277.00

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277.00
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277.00
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277.00

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277.00

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277.00

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277.00

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277.00
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277.00

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277.00

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277.00

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277.00

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277.00

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277.00
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277.00
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Single-cell RNA sequencing of Tocilizumab-treated peripheral blood mononuclear cells as an in vitro mannequin of irritation

COVID-19 has posed a major risk to international well being. Early knowledge has revealed that IL-6, a key regulatory cytokine, performs an essential position within the cytokine storm of COVID-19. A number of trials are due to this fact wanting on the results of Tocilizumab, an IL-6 receptor antibody that inhibits IL-6 exercise, on remedy of COVID-19, with promising findings. 

As a part of a scientific trial wanting on the results of Tocilizumab remedy on kidney transplant recipients with subclinical rejection, we carried out single-cell RNA sequencing of evaluating stimulated PBMCs earlier than and after Tocilizumab remedy. We leveraged this knowledge to create an in vitro cytokine storm mannequin, to higher perceive the consequences of Tocilizumab within the presence of irritation. Tocilizumab-treated cells had lowered expression of inflammatory-mediated genes and biologic pathways, notably amongst monocytes. These outcomes help the speculation that Tocilizumab might hinder the cytokine storm of COVID-19, by way of an indication of biologic influence on the single-cell degree.   

Useful Characterization of a Putative RNA Demethylase ALKBH6 in Arabidopsis Development and Abiotic Stress Responses

RNA methylation and demethylation, which is mediated by RNA methyltransferases (known as “writers”) and demethylases (known as “erasers”), respectively, are rising as a key regulatory course of in plant growth and stress responses. Though a number of research have proven that AlkB homolog (ALKBH) proteins are potential RNA demethylases, the operate of most ALKBHs is but to be decided. 

 The Arabidopsis thaliana genome accommodates 13 genes encoding ALKBH proteins, the capabilities of that are largely unknown. On this research, we characterised the operate of a possible eraser protein, ALKBH6 (At4g20350), throughout seed germination and seedling progress in Arabidopsis below abiotic stresses. The seeds of T-DNA insertion alkbh6 knockdown mutants germinated quicker than the wild-type seeds below chilly, salt, or abscisic acid (ABA) remedy situations however not below dehydration stress situations. 

Though no variations in seedling and root progress had been noticed between the alkbh6 mutant and wild-type below regular situations, the alkbh6 mutant confirmed a a lot decrease survival fee than the wild-type below salt, drought, or warmth stress. Cotyledon greening of the alkbh6 mutants was a lot greater than that of the wild-type upon ABA utility.  Furthermore, the transcript ranges of ABA signaling-related genes, together with ABI3 and ABI4, had been down-regulated within the alkbh6 mutant in comparison with wild-type vegetation. Importantly, the ALKBH6 protein had a capability to bind to each m6A-labeled and m5C-labeled RNAs. Collectively, these outcomes point out that the potential eraser ALKBH6 performs essential roles in seed germination, seedling progress, and survival of Arabidopsis below abiotic stresses.  

GNAS antibody
70R-21619 50 ul
EUR 435.00
Description: Rabbit polyclonal GNAS antibody
GNAS Antibody
ABD7068 100 ug
EUR 438.00
GNAS Antibody
ABD7388 100 ug
EUR 438.00
GNAS antibody
38452-100ul 100ul
EUR 252.00
GNAS Antibody
32899-100ul 100ul
EUR 252.00
GNAS antibody
70R-12940 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal GNAS antibody
GNAS antibody
70R-13520 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal GNAS antibody
GNAS antibody
70R-1643 100 ug
EUR 377.00
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS
GNAS antibody
70R-1651 100 ug
EUR 377.00
Description: Rabbit polyclonal GNAS antibody raised against the C terminal of GNAS
GNAS antibody
70R-1652 100 ug
EUR 377.00
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS
GNAS Antibody
DF7068 200ul
EUR 304.00
Description: GNAS Antibody detects endogenous levels of total GNAS.
GNAS Antibody
DF7388 200ul
EUR 304.00
Description: GNAS Antibody detects endogenous levels of total GNAS.
GNAS Antibody
1-CSB-PA352389LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
GNAS Antibody
1-CSB-PA247539
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100
GNAS Antibody
1-CSB-PA307619LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500
GNAS Antibody
1-CSB-PA009596GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
GNAS Antibody
1-CSB-PA147947
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
GNAS complex locus (GNAS) polyclonal antibody
ABP-PAB-11314 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:
GNAS Complex Locus (GNAS) Antibody (HRP)
20-abx337231
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
GNAS Complex Locus (GNAS) Antibody (FITC)
20-abx337232
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
GNAS Complex Locus (GNAS) Antibody (Biotin)
20-abx337233
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
GNAS Conjugated Antibody
C32899 100ul
EUR 397.00
anti- GNAS antibody
FNab03536 100µg
EUR 505.25
  • Immunogen: GNAS complex locus
  • Uniprot ID: O95467
  • Gene ID: 2778
  • Research Area: Neuroscience, Cancer, Immunology, Signal Transduction
Description: Antibody raised against GNAS
GNAS Antibody (HRP)
20-abx306647
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
GNAS Antibody (FITC)
20-abx306648
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
GNAS Antibody (Biotin)
20-abx306649
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
NESP55,GNAS Antibody
abx235663-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.
GNAS Polyclonal Antibody
A64422 100 µg
EUR 570.55
Description: The best epigenetics products
GNAS Polyclonal Antibody
A68803 100 ?g
EUR 628.55
Description: Ask the seller for details
Anti-GNAS antibody
PAab03536 100 ug
EUR 355.00
Anti-GNAS antibody
STJ72252 100 µg
EUR 359.00
Anti-GNAS antibody
STJ23816 100 µl
EUR 277.00
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.
Anti-GNAS antibody
STJ27492 100 µl
EUR 277.00
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.
Gnas/ Rat Gnas ELISA Kit
ELI-12714r 96 Tests
EUR 886.00
Gnas/ Rat Gnas ELISA Kit
ELI-27931r 96 Tests
EUR 886.00
Gnas/ Rat Gnas ELISA Kit
ELI-35065r 96 Tests
EUR 886.00
Gnas/ Rat Gnas ELISA Kit
ELI-47242r 96 Tests
EUR 886.00
GNAS siRNA
20-abx900009
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GNAS siRNA
20-abx900030
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GNAS siRNA
20-abx918154
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GNAS siRNA
20-abx918155
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GNAS siRNA
20-abx918156
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GNAS siRNA
20-abx918157
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GNAS siRNA
20-abx918158
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GNAS siRNA
20-abx918159
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GNAS siRNA
20-abx918160
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GNAS siRNA
20-abx918161
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
pBluescriptR-GNAS
PVT17793 2 ug
EUR 231.00
Polyclonal GNAS Antibody (Center)
APR05815G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (Center). This antibody is tested and proven to work in the following applications:
anti- NESP55,GNAS antibody
FNab05663 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:50-1:500
  • Immunogen: GNAS complex locus
  • Uniprot ID: O95467
  • Research Area: cancer, Metabolism
Description: Antibody raised against NESP55,GNAS
GNAS Antibody, HRP conjugated
1-CSB-PA352389LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
GNAS Antibody, FITC conjugated
1-CSB-PA352389LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
GNAS Antibody, Biotin conjugated
1-CSB-PA352389LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
GNAS Antibody, HRP conjugated
1-CSB-PA307619LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
GNAS Antibody, FITC conjugated
1-CSB-PA307619LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
GNAS Antibody, Biotin conjugated
1-CSB-PA307619LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Polyclonal GNAS Antibody (aa385-394)
APR02185G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (aa385-394). This antibody is tested and proven to work in the following applications:
Polyclonal GNAS Antibody (N-Term)
AMM04827G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (N-Term). This antibody is tested and proven to work in the following applications:
Polyclonal GNAS Antibody (internal region)
APG00677G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GNAS (internal region). This antibody is tested and proven to work in the following applications:
Polyclonal GNAS Antibody (C-term)
APR04328G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (C-term). This antibody is tested and proven to work in the following applications:
Monoclonal GNAS Antibody, Clone: 7G6G5
AMM03034G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 7G6G5. This antibody is applicable in WB and IHC, FC, ICC, E
Monoclonal GNAS Antibody, Clone: 2A2B7
AMM03035G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 2A2B7. This antibody is applicable in WB and IHC, FC, ICC, E
GNAS Polyclonal Antibody, HRP Conjugated
A64423 100 µg
EUR 570.55
Description: kits suitable for this type of research
GNAS Polyclonal Antibody, FITC Conjugated
A64424 100 µg
EUR 570.55
Description: fast delivery possible
GNAS Polyclonal Antibody, Biotin Conjugated
A64425 100 µg
EUR 570.55
Description: reagents widely cited
GNAS Polyclonal Antibody, HRP Conjugated
A68804 100 ?g
EUR 628.55
Description: The best epigenetics products
GNAS Polyclonal Antibody, FITC Conjugated
A68805 100 ?g
EUR 628.55
Description: kits suitable for this type of research
GNAS Polyclonal Antibody, Biotin Conjugated
A68806 100 ?g
EUR 628.55
Description: fast delivery possible
GNAS cloning plasmid
CSB-CL009596HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1185
  • Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc
  • Show more
Description: A cloning plasmid for the GNAS gene.
GNAS cloning plasmid
CSB-CL009596HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1188
  • Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc
  • Show more
Description: A cloning plasmid for the GNAS gene.
GNAS Rabbit pAb
A5546-100ul 100 ul
EUR 308.00
GNAS Rabbit pAb
A5546-200ul 200 ul
EUR 459.00
GNAS Rabbit pAb
A5546-20ul 20 ul
EUR 183.00
GNAS Rabbit pAb
A5546-50ul 50 ul
EUR 223.00
GNAS Rabbit pAb
A2732-100ul 100 ul
EUR 308.00
GNAS Rabbit pAb
A2732-200ul 200 ul
EUR 459.00
GNAS Rabbit pAb
A2732-20ul 20 ul
EUR 183.00
GNAS Rabbit pAb
A2732-50ul 50 ul
EUR 223.00
GNAS Blocking Peptide
33R-6814 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1643
GNAS Blocking Peptide
33R-10097 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1651
GNAS Blocking Peptide
33R-9925 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-5756
GNAS Blocking Peptide
33R-8471 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1652
GNAS Blocking Peptide
DF7068-BP 1mg
EUR 195.00
GNAS Blocking Peptide
DF7388-BP 1mg
EUR 195.00
Recombinant human GNAS
P1012 100ug Ask for price
  • Uniprot ID: O95467
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human GNAS
pSV40- Gnas- m
PVT11671 2 ug
EUR 273.00
Rat GNAS shRNA Plasmid
20-abx984695
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Rat GNAS shRNA Plasmid
20-abx984696
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Human GNAS ELISA KIT
ELI-12712h 96 Tests
EUR 824.00
Mouse Gnas ELISA KIT
ELI-12713m 96 Tests
EUR 865.00
Canine GNAS ELISA KIT
ELI-27250d 96 Tests
EUR 928.00
GNAS ELISA KIT|Human
EF009911 96 Tests
EUR 689.00
Mouse Gnas ELISA KIT
ELI-48020m 96 Tests
EUR 865.00
Human GNAS ELISA KIT
ELI-48772h 96 Tests
EUR 824.00
Bovine GNAS ELISA KIT
ELI-38027b 96 Tests
EUR 928.00
Mouse GNAS shRNA Plasmid
20-abx970580
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse GNAS shRNA Plasmid
20-abx970581
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse GNAS shRNA Plasmid
20-abx970582
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse GNAS shRNA Plasmid
20-abx970583
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Human GNAS shRNA Plasmid
20-abx951847
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Human GNAS shRNA Plasmid
20-abx951848
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Human GNAS shRNA Plasmid
20-abx951849
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Human GNAS shRNA Plasmid
20-abx951850
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
NESP55/GNAS ELISA KIT|Human
EF001179 96 Tests
EUR 689.00
GNAS ORF Vector (Human) (pORF)
ORF004496 1.0 ug DNA
EUR 95.00
GNAS ORF Vector (Human) (pORF)
ORF004497 1.0 ug DNA
EUR 95.00
Gnas ORF Vector (Rat) (pORF)
ORF067655 1.0 ug DNA
EUR 506.00
Gnas ORF Vector (Rat) (pORF)
ORF067656 1.0 ug DNA
EUR 506.00
Gnas ORF Vector (Rat) (pORF)
ORF067657 1.0 ug DNA
EUR 506.00
Gnas ORF Vector (Rat) (pORF)
ORF067658 1.0 ug DNA
EUR 506.00
Gnas ORF Vector (Rat) (pORF)
ORF067659 1.0 ug DNA
EUR 506.00
Gnas ORF Vector (Mouse) (pORF)
ORF046308 1.0 ug DNA
EUR 506.00
Gnas ORF Vector (Mouse) (pORF)
ORF046309 1.0 ug DNA
EUR 506.00
Gnas ORF Vector (Mouse) (pORF)
ORF046310 1.0 ug DNA
EUR 506.00
Gnas ORF Vector (Mouse) (pORF)
ORF046311 1.0 ug DNA
EUR 506.00
Gnas ORF Vector (Mouse) (pORF)
ORF046312 1.0 ug DNA
EUR 506.00
Gnas ORF Vector (Mouse) (pORF)
ORF046313 1.0 ug DNA
EUR 506.00
Gnas ORF Vector (Mouse) (pORF)
ORF046314 1.0 ug DNA
EUR 506.00
Gnas ORF Vector (Mouse) (pORF)
ORF046315 1.0 ug DNA
EUR 506.00
Mouse Protein ALEX, Gnas ELISA KIT
ELI-24352m 96 Tests
EUR 865.00
Human Protein ALEX, GNAS ELISA KIT
ELI-24547h 96 Tests
EUR 824.00
GNAS sgRNA CRISPR Lentivector set (Human)
K0875301 3 x 1.0 ug
EUR 339.00
Gnas sgRNA CRISPR Lentivector set (Mouse)
K4363501 3 x 1.0 ug
EUR 339.00
Gnas sgRNA CRISPR Lentivector set (Rat)
K7535001 3 x 1.0 ug
EUR 339.00
GNAS-AS1 ORF Vector (Human) (pORF)
ORF020250 1.0 ug DNA
EUR 95.00
pECMV-3脳FLAG-GNAS vector
PVT12057 2 ug
EUR 352.00
GNAS sgRNA CRISPR Lentivector (Human) (Target 1)
K0875302 1.0 ug DNA
EUR 154.00
GNAS sgRNA CRISPR Lentivector (Human) (Target 2)
K0875303 1.0 ug DNA
EUR 154.00
GNAS sgRNA CRISPR Lentivector (Human) (Target 3)
K0875304 1.0 ug DNA
EUR 154.00
Human Neuroendocrine Secretory Protein (GNAS) ELISA Kit
abx387603-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.
Mouse Neuroendocrine Secretory Protein (GNAS) ELISA Kit
abx392277-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.
Rat Neuroendocrine Secretory Protein (GNAS) ELISA Kit
abx392284-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.
Gnas sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4363502 1.0 ug DNA
EUR 154.00
Gnas sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4363503 1.0 ug DNA
EUR 154.00
Gnas sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4363504 1.0 ug DNA
EUR 154.00
Gnas sgRNA CRISPR Lentivector (Rat) (Target 1)
K7535002 1.0 ug DNA
EUR 154.00
Gnas sgRNA CRISPR Lentivector (Rat) (Target 2)
K7535003 1.0 ug DNA
EUR 154.00
Gnas sgRNA CRISPR Lentivector (Rat) (Target 3)
K7535004 1.0 ug DNA
EUR 154.00
GNAS Protein Vector (Mouse) (pPB-C-His)
PV185230 500 ng
EUR 603.00
GNAS Protein Vector (Mouse) (pPB-N-His)
PV185231 500 ng
EUR 603.00
GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185232 500 ng
EUR 603.00
GNAS Protein Vector (Mouse) (pPM-C-His)
PV185233 500 ng
EUR 603.00
GNAS Protein Vector (Mouse) (pPB-C-His)
PV185234 500 ng
EUR 603.00
GNAS Protein Vector (Mouse) (pPB-N-His)
PV185235 500 ng
EUR 603.00
GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185236 500 ng
EUR 603.00
GNAS Protein Vector (Mouse) (pPM-C-His)
PV185237 500 ng
EUR 603.00
GNAS Protein Vector (Mouse) (pPB-C-His)
PV185238 500 ng
EUR 1065.00
GNAS Protein Vector (Mouse) (pPB-N-His)
PV185239 500 ng
EUR 1065.00
GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185240 500 ng
EUR 1065.00
GNAS Protein Vector (Mouse) (pPM-C-His)
PV185241 500 ng
EUR 1065.00
GNAS Protein Vector (Mouse) (pPB-C-His)
PV185242 500 ng
EUR 1065.00
GNAS Protein Vector (Mouse) (pPB-N-His)
PV185243 500 ng
EUR 1065.00
GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185244 500 ng
EUR 1065.00
GNAS Protein Vector (Mouse) (pPM-C-His)
PV185245 500 ng
EUR 1065.00
GNAS Protein Vector (Mouse) (pPB-C-His)
PV185246 500 ng
EUR 1065.00
GNAS Protein Vector (Mouse) (pPB-N-His)
PV185247 500 ng
EUR 1065.00
GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185248 500 ng
EUR 1065.00
GNAS Protein Vector (Mouse) (pPM-C-His)
PV185249 500 ng
EUR 1065.00
GNAS Protein Vector (Mouse) (pPB-C-His)
PV185250 500 ng
EUR 1065.00

Leave a Reply

Your email address will not be published. Required fields are marked *